Review



cas9 d10a nickase  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc cas9 d10a nickase
    Cas9 D10a Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 321 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+d10a+nickase/pmc12830896-288-3-7?v=Addgene+inc
    Average 96 stars, based on 321 article reviews
    cas9 d10a nickase - by Bioz Stars, 2026-08
    96/100 stars

    Images



    Similar Products

    alt-r s.p. cas9 d10a nickase v3  (Integrated DNA Technologies)
    96
    Integrated DNA Technologies alt-r s.p. cas9 d10a nickase v3
    Alt R S.P. Cas9 D10a Nickase V3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+d10a+nickase/custom%401081062%4042209020?v=Integrated+DNA+Technologies
    Average 96 stars, based on 1 article reviews
    alt-r s.p. cas9 d10a nickase v3 - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    cas9-nickase protein (d10a)  (Fasmac Co Ltd)
    86
    Fasmac Co Ltd cas9-nickase protein (d10a)
    Cas9 Nickase Protein (D10a), supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+d10a+nickase/pm41708610-275-18-21?v=Fasmac+Co+Ltd
    Average 86 stars, based on 1 article reviews
    cas9-nickase protein (d10a) - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    cas9 nickase protein d10a 1000 ng ml fasmac  (Fasmac Co Ltd)
    86
    Fasmac Co Ltd cas9 nickase protein d10a 1000 ng ml fasmac
    A and B Targeting wild-type gja5b with an E42K substitution resulted in Snowflake -like phenotypes (A, severe bar disturbance; B, opposite side of the same mosaic individual with wild-type pattern). C/C 1 and D/D 1 <t>CRISPR/Cas9</t> mutations induced by NHEJ in the vicinity of E42 also led to phenotypes similar to Snowflake in G0 fish, displaying moderate bilateral symmetry.
    Cas9 Nickase Protein D10a 1000 Ng Ml Fasmac, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+d10a+nickase/pmc13031650-299-25-29?v=Fasmac+Co+Ltd
    Average 86 stars, based on 1 article reviews
    cas9 nickase protein d10a 1000 ng ml fasmac - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    cas9 d10a nickase  (Addgene inc)
    96
    Addgene inc cas9 d10a nickase
    A and B Targeting wild-type gja5b with an E42K substitution resulted in Snowflake -like phenotypes (A, severe bar disturbance; B, opposite side of the same mosaic individual with wild-type pattern). C/C 1 and D/D 1 <t>CRISPR/Cas9</t> mutations induced by NHEJ in the vicinity of E42 also led to phenotypes similar to Snowflake in G0 fish, displaying moderate bilateral symmetry.
    Cas9 D10a Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+d10a+nickase/pmc12830896-288-3-7?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    cas9 d10a nickase - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    A and B Targeting wild-type gja5b with an E42K substitution resulted in Snowflake -like phenotypes (A, severe bar disturbance; B, opposite side of the same mosaic individual with wild-type pattern). C/C 1 and D/D 1 CRISPR/Cas9 mutations induced by NHEJ in the vicinity of E42 also led to phenotypes similar to Snowflake in G0 fish, displaying moderate bilateral symmetry.

    Journal: Nature Communications

    Article Title: Cell-cell communication as underlying principle governing color pattern formation in teleost fishes

    doi: 10.1038/s41467-026-69524-8

    Figure Lengend Snippet: A and B Targeting wild-type gja5b with an E42K substitution resulted in Snowflake -like phenotypes (A, severe bar disturbance; B, opposite side of the same mosaic individual with wild-type pattern). C/C 1 and D/D 1 CRISPR/Cas9 mutations induced by NHEJ in the vicinity of E42 also led to phenotypes similar to Snowflake in G0 fish, displaying moderate bilateral symmetry.

    Article Snippet: A mixture of Ao-gja5-crRNA2 (40 ng/ml, Target seq: TACGGCAGCCGAGTCTTCGT GGG , PAM ), BaitD-crRNA (40 ng/ml, Target seq: GATCTTCGGCCTAGACTGCG AGG ), tracrRNA (140 ng/ml, FASMAC), Cas9-nickase protein (D10A)(1000 ng/ml, FASMAC), and the donor plasmid (2.5 ng/ml) was microinjected into the cytoplasm of 1- or 2-cell stage fertilized eggs as described previously .

    Techniques: CRISPR